Introduction
Natural resistance-associated macrophage proteins
(NRAMPs) are a highly evolutionarily conserved family of integral membrane
proteins that are widely distributed among diverse organisms, including
bacteria, yeast, algae, plants and animals (Nevo and Nelson 2006). The first NRAMP
gene, NRAMP1, was identified in mammals, and was found to be expressed
in phagosomes of infected macrophages (Vidal et al. 1993). The NRAMPs
participate in resistance to bacterial infection by transporting metal ions
such as manganese (Mn2+) and iron (Fe2+) (Supek et al.
1996; Fleming et al. 1997). The wide distribution of NRAMPs among
different species indicates the importance of their function. Subsequent
studies have shown that NRAMPs exhibit functional divergence and broad
substrate specificity in different species. Various members of the NRAMP family
function as proton-coupled metal ion transporters to transport manganese (Mn2+),
iron (Fe2+), zinc (Zn2+), copper (Cu2+),
cadmium (Cd2+), nickel (Ni2+), cobalt (Co2+),
and aluminum (Al3+) (Colangelo and Guerinot 2006; Nevo and Nelson
2006; Xia et al. 2010; Sasaki et al. 2012; Xiong et al.
2012; Li et al. 2014). These proteins have been implicated in the
uptake, translocation, intracellular transport, and detoxification of
transition metals (Nevo and Nelson 2006). The transport of metal ions in plants
plays important roles in plant growth, development, signal transduction,
nutrition, and protection against heavy metal poisoning. However, most studies
on NRAMPs have been conducted in yeast, and their exact physiological roles in
plants are still poorly understood.
Melon (Cucumis melo L.) is an economically important and
widely cultivated vegetable crop (Huang et al. 2016; Xiong et al.
2018) and is an ideal model for analyzing the development and ripening of
fleshy fruits (Pech et al. 2008; Ezura and Owino 2008). However, great
economic losses are caused by biological and abiotic stresses such as diseases
and adverse environmental conditions. In our previous study using suppression
subtractive hybridization (SSH) analyses, we found that an expressed sequence
tag (EST) (MELO3C019215) encoding a NRAMP was differentially expressed during
the ethylene climacteric burst in melon fruit (Gao et al. 2013).
In this work, the CmNRAMP5
gene fragment was used to identify all NRAMP-like gene sequences in the
melon genome. Then, the expression patterns of CmNRAMP genes in
different tissues at different stages, and in response to different hormones,
stress, and metal ions were determined. Finally, to further understand the
potential functions of these proteins, a protein–protein interaction network
was constructed.
Materials and Methods
Identification of NRAMP
family genes in melon
All
candidate CmNRAMP genes were derived from the melon genome database
(Zheng et al. 2019) using BLASTp searches. The search query was the NRAMP
EST isolated from SSH libraries in our previous study (Gao et al. 2013).
The predicted amino acid sequences of the candidate proteins were searched to
identify NRAMP domains using the Simple Modular Architecture Research Tool
(SMART) (Letunic and Bork 2018). Only the sequences with a full-length NRAMP
domain were considered as CmNRAMPs and used for further analyses.
Sequence alignment,
phylogenetic analysis and conserved motif analysis
Multiple sequence alignment of the identified CmNRAMP
sequences was performed using Clustal W with default parameters and was
adjusted manually. Phylogenetic trees were drawn with MEGA 5.10 software using
the neighbor-joining method, and the reliability of the obtained trees was
assessed with a bootstrap value of 1000 (Tamura et al. 2011). Conserved
motifs were identified using MEME v. 5.1.1 (http://meme-suite.org/tools/meme)
with the following parameters: maximum number of motifs: 12, motif width >6
and <200 (Bailey et al. 2009). The functional interaction networks of
proteins were constructed using tools at the STRING protein interaction
database (http://string-db.org/) with the confidence parameter set at 0.15 and
threshold set at 75. The resulting interaction information was directly
imported into Cytoscape software (3.7.2) for visual editing (Shannon et al.
2003; Szklarczyk et al. 2019).
Promoter analysis and
determination of chromosomal locations
The cis-acting
regulatory elements in the promoter of the NRAMP gene were identified
using tools at the PlantCARE database (Lescot et al. 2002). The promoter
region was defined as the 2-kb sequence upstream of the transcription start
site. Using the sequences of the melon genome and NRAMP genes, we used
TBtools software (Chen et al. 2018) to map the NRAMP genes onto
the chromosomes.
Plant materials and
treatments
Melon (C. melo L. cultivar Hetao) plants were
grown in the field and the mesocarp of fruit (0 to 50 days after pollination;
DAP) and internal ethylene were collected as described previously (Gao et al.
2013). Other tissues, such as roots, stems, young leaves, and flowers were also
collected from greenhouse-grown plants. To minimize the effects of endogenous
hormones on CmNRAMP transcription, sterile young leaves were transferred
to 250-mL flasks containing 100 mL of ½-strength Murashige and Skoog (MS)
liquid medium containing the treatment substance. All plant materials were
sampled in three replicates. The flasks were incubated on a rotary shaker with
shaking (100 rpm) for 2 h at 30°C. The treatments were indole acetic acid (IAA, 0, 0.4, 4, 40 mM),
gibberellic acid (GA3, 0, 0.4, 4, 40 mM),
salicylic acid (SA, 0, 100, 500, 1000 mM)
cytokinin (CTK, 6-benzylaminopurine, 6-BAP, Table 1: Sequences of primers used in
qRT-PCR
|
Gene
name |
Gene
ID |
Forward
primer sequence ( |
Reverse
primer sequence ( |
Product
size (bp) |
|
CmNramp5 |
MELO3C019215 |
CTTGACGGAGAAGGTTGTGGTAAT |
TGGCCGAAAGCAACTGGATC |
248 |
|
CmNramp6 |
MELO3C026742 |
GAGAAATGAAGGGAGGGAGGTT |
GAAGAAGGTGGATTCGACAAGC |
99 |
|
CmNramp1 |
MELO3C023938 |
GTAAAGCTGAGTACCCCAAGGC |
CACCAAACAGGAATGCGGAAG |
136 |
|
CmNramp2 |
MELO3C000512 |
ATCATTGGTGGGTCTTCTGGG |
CCATCTTGGCCTTACTGCTTG |
121 |
|
CmGAPDH |
AB033600 |
ATCATTCCTAGCAGCACTGG |
TTGGCATCAAATATGCTTGACCTG |
278 |
Table 2:
The information including amino acid length, number of exons and introns, and
chromosomal assignment of six CmNRAMP and CmEIN2 genes
|
Gene |
Gene
identification |
Location |
Chromosome
(no.) |
Protein length (no. of amino acids) |
Exons (no.) |
Introns (no.) |
|
CmNRAMP1 |
MELO3C023938 |
24502353-24505332 |
4 |
324 |
9 |
8 |
|
CmNRAMP2 |
MELO3C000512 |
15521339-
15522187 |
0 |
73 |
2 |
1 |
|
CmNRAMP3 |
MELO3C010638 |
7913869-7915404 |
3 |
310 |
7 |
6 |
|
CmNRAMP4 |
MELO3C021848 |
6615332-6617251 |
11 |
283 |
5 |
4 |
|
CmNRAMP5 |
MELO3C019215 |
9194803-9198277 |
11 |
510 |
4 |
3 |
|
CmNRAMP6 |
MELO3C026742 |
25044787-
25048409 |
4 |
324 |
10 |
9 |
|
CmEIN2 |
MELO3C014230 |
29460142-
29457492 |
8 |
1291 |
7 |
6 |
0, 0.4, 4, 40 mM), abscisic acid (ABA, 0, 0.4, 4, 40 mM), brassinosteroid (BR, 0, 0.01, 0.05, 0.1 mg/L),
peroxide (H2O2, 0, 1×104, 2×104,
4×104 mM),
methyl jasmonate (MeJA, 0, 4.46, 44.6, 446 mM) and metal ions of Fe2+ (0, 50, 100,
200 mg/L), Cu2+ (0, 50, 100, 200 mg/L), and Mn2+ (0,
0.272, 1.36, 6.8 mg/L) at different concentrations. Leaves were cultured in
basal medium without any additive as the control. At the end of the culture,
all leaves were removed, blotted dried, frozen in liquid nitrogen and then
stored at −80°C until RNA analysis.
RNA isolation and
qRT-PCR analysis
Total RNA was extracted from
plant samples using RNAiso for polysaccharide-rich plant tissue (Takara, Otsu,
Japan) as per manufacturer’s instructions. All RNA extracts were analyzed by
agarose gel electrophoresis and UV spectrophotometry.
The CmNRAMP
mRNA levels were measured by quantitative PCR (qPCR). The primers (Table 1)
were designed using Primer Premier v. 5.0, avoiding the conserved regions of
the NRAMP motif and focusing on intron regions to reduce potential DNA
contamination. For each trial, nine independent experiments were conducted
(each experiment had three biological replicates, and each sample was analyzed
with three technical replicates). All relative -fold differences in expression
were normalized to the transcript level of GAPDH.
First-strand
cDNA was synthesized using the PrimeScript® RT reagent kit with gDNA eraser
(Perfect Real Time; Takara) following the manufacturer’s protocol. For cDNA
synthesis, 0.5 μg of total RNA from each sample was used as
template in a 10-μL reaction mixture. SYBR® Premix Ex Taq™ II (Tli
RNaseH Plus; Takara) was used for real-time RT-PCR, with 5 μM of each primer, and the reactions were run on a
Mastercycler® ep realplex (Eppendorf, Hamburg, Germany). Melting curves were
generated immediately after the last cycle to exclude any influence of primer
dimers. Cycle numbers at which the fluorescence passed the cycle threshold (Ct)
were analyzed, and relative expression was calculated by the 2-ΔΔCt
method. The differences were analyzed using DPS (Data Processing System)
software (Tang and Zhang 2013).
Results
Gene identification and
sequence analysis
We mapped the chromosomal locations of the genes based
on the location information shown in Table 2, using TBtools software (Fig. 1). CmNRAMP1
and CmNRAMP6 were located on chromosome 4, CmNRAMP4 and CmNRAMP5
were located on chromosome 11 and the rest were located on different
chromosomes.
Next,
we analyzed the phylogenetic relationships between melon NRAMP genes and
their homologs in A. thaliana and O. sativa. The tree had two
large groups, in which both monocots and dicots were distributed (Fig. 2, Table
S1). One group contained OsNRAMP1/6/5/4/3, AtNRAMP1/6, CmNRAMP3/4,
and CmNRAMP1/6. OsNRAMP6/5/4/3 and AtNRAMP1/6 are plasma
membrane-localized proteins. In rice, OsNRAMP4 (NRAT1) functions as a
transporter specific for trivalent Al3+ (Xia et al. 2010; Li et
al. 2014); OsNRAMP5 plays a role in the uptake of Mn2+, Fe2+,
and Cd2+ from the soil (Sasaki et al. 2012); OsNRAMP6 is
involved in uptake of Fe2+ and Mn2+, and contributes to
disease resistance (Peris-Peris et al. 2017); and OsNRAMP3 functions as
a switch in response to environmental Mn2+ changes (Yamaji et al.
2013). In Arabidopsis, AtNRAMP1/6 mediates Mn2+ uptake and Cd2+
toxicity, respectively (Cailliatte et al. 2009, 2010). The other group
contained CmNRAMP5, AtNRAMP2/3/4/5 and OsNRAMP2/7. AtNRAMP3/4 are functionally redundant, and transport
Fe2+ and Mn2+ and the toxic metal ion Cd2+
(Lanquar et al. 2005). AtNRAMP2 transports Mn2+ via the
trans-Golgi network to support reactions in photosynthesis and cellular redox
homeostasis (Alejandro et al. 2017; Gao et al. 2018).
To further examine
the sequence features of plant NRAMPs, we conducted a comparative analysis of
the %20327-337_files/image002.png)
Fig. 1:
Chromosomal locations of melon NRAMP genes
Chr represents the chromosomes.
The lengths of chromosomes of each NRAMP gene are displayed proportionately. Black lines on bars indicate the
locations of NRAMP genes
conserved motifs among NRAMPs in
melon, Arabidopsis, and rice. Twelve motifs were detected in NRAMP amino
acid sequences, as revealed by analyses using the MEME program (Fig. S1). In
general, NRAMPs that clustered in the same subgroups shared similar motif
compositions (Fig. 2), indicating functional similarities among members of the
same subgroup. Nearly all of the NRAMP members contained motifs 3, 1, 5, 9, 4,
and 6, suggesting that these motifs are important for the functions of NRAMPs.
Motif 12 was only present in members of subgroup II. All the members of this
group except for AtNRAMP5 contained 12 motifs. Four NRAMPs in melon were
shorter than their homologs in other plants. CmNRAMP3 and CmNRAMP4
were located on different chromosomes, and their encoded proteins lacked N and
C-terminal motifs and the N-terminal motif, respectively. The proteins encoded
by CmNRAMP6 and CmNRAMP1 contained N-terminal motifs, but only CmNRAMP5
contained all motifs. The differences in motif distribution among NRAMPs
suggested that the functions of their encoded proteins have diverged during
evolution.
To better understand the
potential regulation of CmNRAMP genes, we searched their promoter
regions for cis-acting elements (Table S2). The
promoter regions contained hormone response elements including methyl jasmonate
(MeJA)-, gibberellin-, auxin- and SA-response elements; as well as low
temperature-, drought-, and light-response elements. The results provided the
basis for selecting different exogenous hormones to treat melon for analyses of
CmNRAMP gene expression patterns.
%20327-337_files/image004.jpg)
Fig. 2: Motif
analysis of NRAMP proteins in C. melo, A. thaliana and O. sativa
A
phylogenetic tree was constructed by MEGA5.10. Different subfamilies are marked
with different color backgrounds. Motifs in the NRAMP proteins were elucidated
by MEME. Different motifs are represented by different colored numbered boxes
%20327-337_files/image006.jpg)
Fig. 3: Functional interaction networks
of CmNRAMP proteins in melon according to STRING database and Cytoscape
software 3.7.2 (IDARE)
Protein–protein
interaction analysis
To explore the interactions between NRAMPs and other
proteins in melon, an interaction network was built. The CmNRAMP sequences were
used as queries to obtain interacting protein information in the STRING
database and the corresponding value was derived. The protein ID in the STRING
database was converted into the ID in the Uniprot database, and the network was
visualized using Cytoscape.
A total of 192
proteins were obtained from the STRING database to construct the PPI, including
proteins that %20327-337_files/image008.jpg)
Fig. 4: Functional
interaction networks of CmNRAMP proteins in melon according to STRING database
and Cytoscape software 3.7.2 (ClueGO)
The parallelogram indicates
biological process, triangle indicates molecular function, and V-type indicates
KEGG
participate in transmembrane
transport, superoxide dismutase (SOD) activity, ATPase-coupled transmembrane
transporter activity, signal transduction by protein phosphorylation, plant
hormone signal transduction, nicotianamine synthase activity, endosomal
transport, spliceosomes,
porphyrin and chlorophyll metabolism, divalent metal ion transport,
phosphatidylinositol binding, and pyridoxal phosphate binding (Fig. 3, Fig. 4, Fig.
S2 and Table S3).
The NRAMPs are metal ion
transporters, and the dynamic equilibrium of metal ions is known to affect
diverse physiological responses. Our network analysis suggested that NRAMPs may
play several roles in plant ethylene signal transduction. First, NRAMPs
directly interact with VSP and CDC, which interact with EIN2. Second, NRAMPs
have indirect interactions, with PP2C and other ethylene signal transduction
proteins via their interaction with
COP5.1 (all CmNRAMPs except CmNRAMP5) or CaT (all NRAMPs), or with EIN2
via their interactions with CaT (all CmNRAMPs).
The protein–protein interaction
analysis also indicated that NRAMPs interact with the transcription factors FER
and MT to affect SOD activity; and interact with IRT to affect the regulation
of some transcription factors (bHLH47, bHLH 92, bHLH
100, bHLH 101). Interactions with HMA3 and HMA3L affect the regulation of GLP
(involved in pathogen resistance), SAUR71 (involved in IAA signaling), and CCS
(a copper chaperone for SOD). The interaction with CDC5L regulates spliceosomes
via SYF1, SKIP, U5S1, and PRL1. Only CmNRAMP5 from the NRAMP family may
directly interact with NKCC1 for regulation of SPA1, PSMB, PDH51, and DAGLB.
Expression analyses
Only four members of the gene family were annotated in
the fruit transcriptome data (unpublished data). The qRT-PCR analyses confirmed
that the other two family members were expressed at low levels or not expressed
in the leaves. Therefore, the expression patterns of only four CmNRAMP
genes were analyzed in this study.
Expression
profiles of CmNRAMP
genes in different tissues: The expression patterns of CmNRAMP genes in %20327-337_files/image010.png)
Fig. 5: Expression analysis of selected
melon NRAMP genes in (A)
different tissues and (B) fruit
development stages using quantitative reverse-transcription polymerase chain
reaction
different
tissues (roots, stem, leaves, and flowers) or fruit at different developmental
stages (every 5 days from 0 to 50 DAP) were analyzed by qRT-PCR to explore
their potential functions during the vegetative and reproductive development of
melon.
The four analyzed CmNRAMP
genes were detected in all tissues and showed variable transcript levels (Fig. 5A). The transcript
levels of CmNRAMP 2, 5, and 6 were the highest in the stem,
leaves, and roots, respectively, and their transcript levels in these three
tissues were not significantly different. CmNRAMP1 was abundantly expressed in the roots,
and at significantly different levels among other tissues.
CmNRAMP genes showed high transcript
levels during the fruit development stage (15–25 DAP), while the transcript
level of CmNRAMP5 peaked at the same time as the climacteric peak
of ethylene production (Fig. 5B). This result indicated that the expression of CmNRAMPs
is at least partially ethylene-dependent or might be upstream regulator of
ethylene.
Expression of CmNRAMP genes under different hormone
treatments: We determined the changes in the transcript levels of CmNRAMP genes in response to treatments with ABA, CTK (6-BAP), BR, IAA, SA,
MeJA, and GA at a range of concentrations. The transcript levels were
quantified by qRT-PCR (Fig. 6).
Compared with the control group
(0 μmol/L), the
groups treated with ABA showed significantly decreased transcript levels of CmNRAMP1,
5, and 6. The transcript level of CmNRAMP2 increased and then
decreased with increasing ABA concentrations.
Compared with the control, the
groups treated with CTK tended to show decreased transcript levels of CmNRAMP1,
5, and 6 while that of CmNRAMP2 decreased, increased, and
then decreased with increasing CTK concentrations. The results indicated that
the gene transcript levels were significantly different between the control and
the 40 mmol/L CTK treatment, but not
among the 0.4 μmol/L, 4 μmol/L and 40 μmol/L treatments. There was no significant difference
in transcript levels among CmNRAMP1, 2 and 6 in each CTK
treatment.
In the BR treatment, the
transcript level of CmNRAMP1 increased then decreased, those of CmNRAMP2
and 6 increased, and that of CmNRAMP5 decreased, compared with
their respective levels in the control. The results indicated that there was no
significant difference in transcript levels among CmNRAMP1, 2, and 6
at each BR concentration. The transcript level of CmNRAMP5 showed the
largest decrease in the 0.05
mg/L BR treatment,
to 0.1 times that in the control group. The results indicated that the
transcript level of CmNRAMP5 differed significantly between the control
and the 0.1 mg/L BR treatment, and between the
control and the 4 mol/L BR treatment (extremely significant difference), but
did not differ significantly among the 0.01 mg/L, 0.05 mg/L and 0.1 mg/L BR treatments.
In the IAA treatment, the
transcript levels of the four genes decreased then increased with increasing
IAA concentrations. The results indicated that there was no significant
difference in transcript levels among CmNRAMP1, 2, and 6. The transcript level of CmNRAMP5
in the 0.4 μmol/L IAA treatment was only 0.31
times that in the
control group, but was 12.41 times that in the control group in the 40 μmol/L IAA treatment. The results
indicated that the expression level of CmNRAMP5 differed significantly
between the 40 μmol/L and 4 μmol/L IAA treatments, and between the control and the 40 μmol/L IAA treatment (extremely significant difference). There was no
significant difference in the CmNRAMP5 transcript levels among the
control and the 0.4 μmol/L and 4 μmol/L IAA treatments.
Treatment with SA increased the
transcript levels of CmNRAMP1, 2, 5, and 6, compared with the control. The
results indicated that the transcript levels of CmNRAMP6 in the 100 μmol/L and 500 μmol/L SA treatments were
significantly different from that in the control. The transcript levels of
CmNRAMP6 did not differ significantly among the other SA treatments.
%20327-337_files/image012.jpg)
Fig. 7: Expression analysis of selected
melon NRAMP genes in three heavy metal treatment using quantitative
reverse-transcription polymerase chain reaction
%20327-337_files/image014.png)
Fig. 6: Expression analysis of selected
melon NRAMP genes in different hormones and stress treatment using
quantitative reverse-transcription polymerase chain reaction (A and B)
In the MeJA treatments, the
transcript levels of the four genes increased, decreased and then increased. CmNRAMP2
and 5 had the highest
transcript levels in the 4.46 μmol/L treatment, which were 10.64 and
21.61 times that in the control, respectively. The transcript level of CmNRAMP5
in the 4.46 μmol/L MeJA treatment was significantly
different from those in the control and 44.6 μmol/L MeJA.
In the GA treatments, the
transcript levels of the four genes were highest in the 0.4 μmol/L GA treatment. The CmNRAMP6 transcript levels were significantly
different between the 0.4
μmol/L and 4 μmol/L GA treatments, and extremely
significantly different between the 0.4 μmol/L GA treatment and the control.
Expression of CmNRAMP genes in response to H2O2: Treatment with H2O2 increased the
transcript levels of all CmNRAMP genes, compared with the control. There was no
significant difference in transcript levels among the four genes (Fig. 6).
Expression of CmNRAMP genes under different metal treatments: We determined changes in the transcript
levels of CmNRAMP genes
in melon roots in response to treatments with Mn2+, Cu2+,
and Fe2+ using qRT-PCR analyses (Fig. 7).
Treatments
with Mn2+ increased the transcript levels of CmNRAMP5 and
6, with both showing peak levels in the 0.272 mg/L Mn2+
treatment. There was no significant difference in the transcript levels of CmNRAMP2,
5, and 6 among the Mn2+ treatments. CmNRAMP1
was down-regulated by Mn2+ treatments, with the lowest transcript
level in the 0.272 mg/L Mn2+ treatment. The transcript levels of CmNRAMP1
differed significantly between the control and the Mn2+
treatments.
Treatment
with Cu2+ up-regulated CmNRAMP5 and 6, suggesting
their encoded proteins have transporter activity in melon. Both genes were most
strongly induced in the 100 mg/L Cu2+ treatment, and were
significantly higher in that group than in the control and other Cu2+
treatments. CmNRAMP2 was down-regulated by Cu2+, with the
lowest transcript level in the 100 mg/L Cu2+ treatment, where it was
significantly lower than that in the control. However, the transcript levels of
CmNRAMP1 were similar among all the Cu2+ treatments.
Treatment
with Fe2+ up-regulated CmNRAMP5 and 6, down-regulated
CmNRAMP1, and did not affected CmNRAMP2. These results suggested
that CmNRAMP5 and 6 may have
transporter activity in melon. The up-regulated genes were most highly induced
by Fe2+ at 100 mg/L, and their transcript levels were
significantly higher than those in the control. The down-regulation of CmNRAMP1
was approximately the same among all the Fe2+ treatments, and
its transcript levels were significantly lower than those in the control.
Discussion
Fruit
ripening is regulated by a great deal of stimuli, including light, water
availability, plant nutrient status, temperature, and hormones (Gao et al.
2013; Huang et al. 2016). Melon is an economically important and widely
cultivated vegetable crop that provides nutrients in the daily diet of consumers
(Bie et al. 2017). In plant cells, metal ions are involved in
physiological and biochemical reactions, and these reactions are affected by
the enrichment and transport of metal ions. Therefore, it is important to study
the relationship between metal transporters and the amount of heavy metal
residues that accumulate during fruit development. Previous studies have shown
that members of the NRAMP carrier family participate in the maintenance of
metal homeostasis in Arabidopsis, rice, soybean, Malus baccata,
Malus xiaojinensis, peanut, and Brassica napus (Xiao et al.
2008; Xiong et al. 2012; Zha et al. 2014; Pan et al. 2015;
Meng et al. 2017; Qin et al. 2017). However, no detailed
information was available for this family of transporters in melon. Here, we
used a bioinformatics approach to identify the members of NRAMP family in the C.
melo genome and to determine their biological roles during melon
development.
In this study, searches of the melon genome revealed six putative CmNRAMP
genes. Phylogenetic analysis clustered all of their encoded proteins into two
distinct subfamilies. The subcellular localization of proteins in the same subfamily was similar among Arabidopsis,
rice, common bean, and soybean (Qin et al. 2017; Mani and
Sankaranarayanan 2018; Ishida et al. 2018). Interestingly, all of the
melon NRAMPs except CmNRAMP5 contained fewer motifs and had
shorter amino acid sequences than their homologs in other plants. Only CmNRAMP5, which was in its own
subfamily, had the 12 characteristic NRAMP motifs.
We detected cis-acting elements in the promoter regions of CmNRAMPs
and monitored changes in gene transcript levels in response to various
treatments. These analyses revealed several hormone-responsive elements in the CmNRAMPs
promoters. In the expression analyses, all the CmNRAMPs were
up-regulated by SA, especially CmNRAMP6. CmNRAMP1/5/6 were
down-regulated by ABA, and all the CmNRAMPs were up-regulated by H2O2.
Treatment with IAA affected the transcript levels of CmNRAMP5, while
treatment with GA affected the transcript levels of CmNRAMP6. CmNRAMP5
transcript levels were affected by treatments with CTK, MeJA, and BR.
There were significant changes in the transcript levels of CmNRAMP1/5/6
in response to Fe2+; of CmNRAMP2/5/6 in response to Cu2+;
and of CmNRAMP1 in response to Mn2+. The closest homologs of CmNRAMP5
in Arabidopsis are AtNramp3/4. The transcript levels of AtNRAMP4
were shown to be greatly increased by 24 and 72 h of exposure to excess Cu
(Zlobin et al. 2015). Our results and those of other studies indicate
that the CmNRAMPs play important
roles in responses to plant hormones and in maintaining metal ion homeostasis
in melon.
NRAMPs are known to transport divalent metal ions, and some of them
show functional redundancy, such as AtNRAMP3 and AtNRAMP4
(Lanquar et al. 2005). However, some members of the NRAMP family can
transport other ions, such as trivalent Al3+ (Li et al.
2014). Pleiotropy of the NRAMPs can be demonstrated through PPI network
analyses, and is fundamental for understanding their function. The ClueGO
results indicated that the largest category of proteins in the protein–protein
interaction network was transmembrane transporters. Other highly represented
proteins were related to SOD activity, signal transduction by protein phosphorylation
(MKKs), plant hormone signal transduction (ethylene, auxin, ABA), and
spliceosomes (CDC5L) (Fig. 4).
The protein–protein interaction network included proteins involved in
plant hormone signal transduction. Several metal ions, especially Cu2+
have a critical role in ethylene perception and ethylene signaling (Hirayama
and Alonso 2000). Ethylene perception requires Cu2+ for binding to
ethylene receptors. In addition, EIN2, which has an NRAMP-like motif in
N-terminal, plays positive role in ethylene signaling, especially the
phosphorylation-dependent cleavage from endoplasmic reticulum and nuclear
movement of the EIN2-CEND peptide (Qiao et al. 2012). In melon
overexpressing CmNRAMP5, the peak in the internal ethylene concentration
in fruits occurred earlier than in wild type (unpublished result). SAUR71 is expressed in the steles
of young roots and hypocotyls, and is differentially expressed during stomatal
formation (Qiu et al. 2013). LAX2 is an auxin-responsive and/or
auxin-related gene, and is strongly expressed in the primary root cap, where it
is involved in specification of the quiescent center in Arabidopsis (Saito
et al. 2019). PYL proteins are ABA receptors in Arabidopsis, and
ABA perception by PYR/PYLs plays a major role in the regulation of seed
germination and establishment (Gonzalez-Guzman et al. 2012). PYL1
inhibits protein phosphatase-type 2C upon binding of pyrabactin, an ABA
agonist, whereas PYL2 appears relatively insensitive to this compound (Yuan et
al. 2010).
The CDC5L protein is a core component of the putative E3 ubiquitin
ligase complex, which plays roles in pre-messenger RNA splicing and in the
cellular response to DNA damage. Recent studies have described a new function
for CDC5L in the regulation of the ATR-mediated cell-cycle checkpoint in
response to genotoxic agents (Zhang et al. 2009). It has been reported
that CDC5 is involved in the ABA-mediated flooding tolerance of soybean
(Komatsu et al. 2013), and is responsible for cell division and
expansion during the thickening of the taproot in radish
(Xie et al. 2018).
AtVPS35, which is localized in the pre-vacuolar compartment and
immunoprecipitates with VPS29, is involved in sorting proteins to protein
storage vacuoles in seeds, possibly by recycling vacuolar sorting receptor from
the prevacuolar compartment to the Golgi complex. It is also involved in plant
growth and senescence in vegetative organs (Yamazaki et al. 2008).
AtVPS29 plays an important role in the trafficking of soluble proteins to the
lytic vacuole from the trans-Golgi network to the prevacuolar compartment (Kang
et al. 2012). The retromer components VPS35A and VPS29 are essential for
normal prevacuolar compartment morphology and normal trafficking of plasma
membrane proteins in plants (Nodzyński et al. 2013). A recent study
showed that ZmVPS29 is involved in auxin accumulation during early kernel
development in maize (Chen et al. 2020). An evolutionarily conserved
VPS26 protein (VPS26C; At1G48550) functions in a complex with VPS35A and VPS29,
which are necessary for root hair growth in Arabidopsis (Jha et al.
2018).
Other proteins identified in the protein–protein interaction network
are known to have functions in transporting, binding, chelating, and
chaperoning metal ions. These proteins had close homologs in Arabidopsis
such as: (1) metal transporters (COPT5, YSL2); (2) enzymes involved in metal
chelator synthesis (NAS1, and NAS2); (3) metal-binding proteins, including
metallothionein (MT2); (4) metallochaperones (CCS); (Zlobin et al. 2015)
and (5) metal tolerance proteins (MTPC2, MTPC4, MTP4, MTP11).
In previous studies on Arabidopsis, elevated Cu concentrations
induced CCS and YSL2 expression and inhibited NAS2
expression in roots, and induced CCS and NRAMP4 expression in
leaves. In canola, Fe and Mn contents in leaves were significantly decreased
when plants were treated with Cu at high concentrations. The AtNRAMP3,
AtNRAMP4 double mutant contained fewer functional photosystem II complexes,
indicating that NRAMP transporters play important roles in photosystem II formation
(Lanquar et al. 2010). Some proteins are known to interact with
porphyrin and chlorophyll metabolism. Among them, CAO, which is located on the
inner envelope and thylakoid membranes of chloroplasts in Arabidopsis
and barley, was able to catalyze the conversion of chlorophyllide a to
chlorophyllide b in vitro (Reinbothe et al. 2006). Genetic
studies have shown that ChlM is critical for chlorophyll biosynthesis and
chloroplast development in tobacco and Arabidopsis (Alawady and Grimm
2005; Pontier et al. 2007). Proteins with phosphatidylinositol binding
activity include SNX1, whose expression is induced by salt. This protein has NO
synthase-like activity and produces NO under salt stress, which plays a crucial
role in the development of salt tolerance (Li et al. 2018)
Under Fe deficiency, exogenous NaCl was shown to promote the
reutilization of cell wall Fe, and participate in the translocation of Fe from
roots to shoots in Arabidopsis, partially because of its effects on ABA
content. This was associated with the up-regulation of genes encoding
proteins related to the long-distance transport of Fe, such as NAS1
(Nicotianamine Synthase1), YSL2 (Yellow Stripe-Like) and FRD3 (Ferric
Reductase Defective3) (Zhu et al. 2017).
HMA3 encodes heavy metal ATPase 3, which is responsible for cadmium (Cd)
detoxification. In Sedum plumbizincicola, SpHMA3 was found to be highly
expressed in shoots and its encoded protein was localized to the tonoplast (Liu
et al. 2017). Overexpression of OsHMA3 increased Cd tolerance, and
the plants produced rice grains with almost no Cd, also had little effect on
grain yield or on the concentrations of Zn, Fe, Cu, and Mn (Lu et al.
2019).
A previous transcriptome study suggested that oxidative stress and
protein denaturation are important contributors to arsenic (As) and Cd toxicity
(Verbruggen et al. 2009). Phosphate (P) fertilizers are widely used in
modern agriculture to improve crop growth. A higher P supply increases As and
Cd uptake in shoots and roots, and excess heavy metals increase oxidative
damage mediated by reactive oxygen species (ROS). The ROS are generated as a
by-product of physiological reactions such as electron flow in chloroplasts and
mitochondria and some redox reactions. The first line of defense against ROS is
SODs, a group of metalloenzymes that include Cu/Zn SOD, Mn SOD, and Fe SOD
(Ozturk et al. 2010; Kung et al. 2014). Exposure to Cd was shown
to increase the expression of SOD genes in rice, but SOD expression in
shoots and roots was found to decrease when rice plants were exposed to Cd
without a phosphorus (P) supply, resulting in oxidative damage (Wang et al.
2015). Other studies have shown that P deficiency affects Fe storage, as
indicated by the accumulation of Fe associated with ferritin in chloroplasts.
Inside chloroplasts, the expression of the ferritin gene, AtFer1, is
regulated by the phosphate starvation response transcription factor AtPHR1, but
this transcription factor does not affect the transcription of ITR1,
which encodes a protein involved in Fe-uptake (Hirsch et al. 2006;
Bournier et al. 2013). In soybean, most NRAMP genes displayed
contrasting responses to Fe and sulfur deficiencies (Qin et al. 2017).
The ATX1-like domain at the N terminus is essential for the Cu chaperone
function of AtCCS in planta; this protein is essential for the
integration of Cu into Cu/Zn SOD (Chu et al. 2005).
Conclusion
In this study, we identified the members of the NRAMP
gene family in melon. Our results showed that only CmNRAMP5 has all the
characteristic motifs, while the other five CmNRAMP have shorter amino acid
sequences. The presence of particular cis-acting elements in the CmNRAMP
promoter sequences and the expression patterns of the genes under different
treatments, as verified by qPCR, indicate that the members of the NRMAP
gene family respond to different plant hormones and metal ions. A
protein–protein interaction analysis indicated that melon NRAMPs functions as
metal ion transporters and interact with proteins involved in SOD activity,
plant hormone signal transduction, signal transduction by protein
phosphorylation, and nicotianamine synthase activity. This study provides
insights into the diversity of melon NRAMPs, and provides baseline data for
further comprehensive and in-depth analyses of their functions.
Acknowledgement
We
acknowledge the financial support of the National Natural Science Foundation of
China (No.31660577), Natural
Science Foundation of Inner Mongolia Autonomous Regin (2020MS03013) and Program for Young Talents
of Science and Technology in Universities of Inner Mongolia Autonomous Region
(No. NJYT-19-B19). The English text of a draft of this manuscript was edited by
Jennifer Smith, PhD, from Liwen Bianji, Edanz Group China.
Author Contributions
Agula Hasi and Feng Gao conceived and designed the
experiments; Yufeng Zhuang and Lan Jin performed the experiments; Bayaer Enhe
analyzed the data; Lan Jin wrote the paper.
References
Alawady AE, B Grimm (2005). Tobacco Mg protoporphyrin IX
methyltransferase is involved in inverse activation of Mg porphyrin and
protoheme synthesis. Plant J 41:282‒290
Alejandro S, R Cailliatte, C Alcon, L Dirick, F Domergue, D Correia, L
Castaings, JF Briat, S Mari, C Curie (2017). Intracellular distribution of
manganese by the trans-Golgi network transporter NRAMP2 is critical for photosynthesis and
cellular redox homeostasis. Plant Cell 29:3068‒3084
Bailey TL, M Bodén, FA Buske, M Frith,
CE Grant, L Clementi, J Ren, WW Li, WS Noble (2009). MEME SUITE: tools for
motif discovery and searching. Nucl Acids Res 37:202‒208
Bie Z, MA Nawaz, Y Huang, JM Lee, G Colla (2017). Introduction to
vegetable grafting. In: Vegetable
Grafting. Principles and Practices, pp: 1‒21. Colla G, FP Alfocea, D
Schwarz (Eds.). CABI Publishing, Wallingford, UK
Bournier M, N Tissot, S Mari, J Boucherez, E Lacombe, JF Briat, F
Gaymard (2013). Arabidopsis ferritin 1 (AtFer1)
gene regulation by the phosphate starvation response 1 (AtPHR1) transcription
factor reveals a direct molecular link between iron and phosphate homeostasis. J
Biol Chem 288:22670–22681
Cailliatte R, A Schikora, JF Briat, S Mari, C Curie (2010).
High-affinity manganese uptake by the metal transporter NRAMP1 is essential for Arabidopsis growth in low manganese
conditions. Plant Cell 22:904‒917
Cailliatte R, B Lapeyre, JF Briat, S Mari, C Curie (2009). The NRAMP6 metal transporter contributes to
cadmium toxicity. Biochem J 422:217‒228
Chen C, H Chen, Y He, R Xia (2018). TBtools, a toolkit for biologists
integrating various HTS-data handling tools with a user-friendly interface. bioRxiv
2018; Article 289660
Chen L, YX Li, C Li, Y Shi, Y Song, D Zhang, H Wang, Y Li, T Wang
(2020). The retromer protein ZmVPS29
regulates maize kernel morphology likely through an auxin-dependent
process(es). Plant Biotechnol J 18:1004‒1014
Chu CC, WC Lee, WY Guo, SM Pan, LJ Chen, H Li, TL Jinn (2005). A copper
chaperone for superoxide dismutase that confers three types of copper/zinc
superoxide dismutase activity in Arabidopsis.
Plant Physiol 139:425‒436
Colangelo EP, ML Guerinot (2006). Put the metal to the petal: Metal
uptake and transport throughout plants. Curr Opin Plant Biol 9:322‒330
Ezura H, WO Owino (2008). Melon, an alternative model plant for
elucidating fruit ripening. Plant Sci 175:121‒129
Fleming MD, CC Trenor, MA Su, D Foernzler, DR Beier, WF Dietrich, NC
Andrews (1997). Microcytic anaemia mice have a mutation in Nramp2, a candidate
iron transporter gene. Nat Genet 16:383‒386
Gao F, Y Niu, J Hao, R Bade, L Zhang, A Hasi (2013). Identification of
genes differentially expressed during ethylene climacteric of melon fruit by
suppression subtractive hybridization. J Integr Agric 12:1431‒1440
Gao H, W Xie, C Yang, J Xu, J Li, H Wang, X Chen, CF Huang (2018). NRAMP2, a trans-Golgi network-localized
manganese transporter, is required for Arabidopsis root growth under manganese
deficiency. New Phytol 217:179‒193
Gonzalez-Guzman M, GA Pizzio, R Antoni, F Vera-Sirera, E Merilo, GW
Bassel, MA Fernández, MJ Holdsworth, MA Perez-Amador, H Kollist, PL Rodriguez
(2012). Arabidopsis PYR/PYL/RCAR receptors play a major role in quantitative
regulation of stomatal aperture and transcriptional response to abscisic acid. Plant
Cell 24:2483‒2496
Hirayama T, JM Alonso (2000). Ethylene captures a metal! metal ions are
involved in ethylene perception and signal transduction. Plant Cell Physiol
41:548‒555
Hirsch J, E Marin, M Floriani, S Chiarenza, P Richaud, L Nussaume, MC
Thibaud (2006). Phosphate deficiency promotes modification of iron distribution
in Arabidopsis plants. Biochimie
88:1767‒1771
Huang Y, W Li, L Zhao, T Shen, J Sun, H Chen, Q Kong, MA Nawaz, Z Bie
(2016). Melon fruit sugar and amino acid contents are affected by fruit setting
method under protected cultivation. Sci Hortic 214:288‒294
Ishida JK, DGG Caldas, LR Oliveira, GC Frederici, LMP Leite, TS Mui
(2018). Genome-wide characterization of the NRAMP gene family in Phaseolus
vulgaris provides insights into functional implications during common bean
development. Genet Mol Biol 41:820‒833
Jha SG, ER Larson, J Humble, DS Domozych, DS Barrington, ML Tierney
(2018). Vacuolar protein sorting 26C encodes an evolutionarily conserved large
retromer subunit in eukaryotes that is important for root hair growth in Arabidopsis thaliana. Plant J
94:595‒611
Kang H, SY Kim, K Song, EJ Sohn, Y Lee, DW Lee, I Hara-Nishimura, I
Hwang (2012). Trafficking of vacuolar proteins: the crucial role of Arabidopsis vacuolar protein sorting 29
in recycling vacuolar sorting receptor. Plant Cell 24:5058‒5073
Komatsu S, C Han, Y Nanjo, M Altaf-Un-Nahar, K Wang, D He, P Yang
(2013). Label-free quantitative proteomic analysis of abscisic acid effect in
early-stage soybean under flooding. J Proteom Res 12:4769‒4784
Kung CP, YR Wu, H Chuang (2014). Expression of a dye-decolorizing
peroxidase results in hypersensitive response to cadmium stress through
reducing the ROS signal in Arabidopsis.
Environ Exp Bot 101:47‒55
Lanquar V, MS Ramos, F Lelièvre, H Barbier-Brygoo, A Krieger-Liszkay, U
Krämer, S Thomine (2010). Export of vacuolar manganese by AtNRAMP3 and AtNRAMP4 is
required for optimal photosynthesis and growth under manganese deficiency.
Plant Physiol 152:1986‒1999
Lanquar V, F Lelièvre, S Bolte, C Hamès, C Alcon, D Neumann, G Vansuyt,
C Curie, A Schröder, U Krämer, H Barbier-Brygoo, S Thomine (2005). Mobilization
of vacuolar iron by AtNRAMP3 and AtNRAMP4 is essential for seed
germination on low iron. EMBO J 24:4041‒4051
Lescot M, P Déhais, G Thijs, K Marchal, Y Moreau, VVD Peer, P Rouzé, S
Rombauts (2002). PlantCARE, a database of plant cis-acting regulatory elements
and a portal to tools for in silico analysis of promoter sequences. Nucl Acids
Res 30:325‒327
Letunic I, P Bork (2018). 20 years of the SMART protein domain
annotation resource. Nucl Acids Res 46:493‒496
Li JY, J Liu, D Dong, X Jia, SR McCouch, LV Kochian (2014). Natural
variation underlies alterations in Nramp aluminum transporter (NRAT1) expression and function that play
a key role in rice aluminum tolerance. Proc Natl Acad Sci USA 111:6503‒6508
Li TT, WC Liu, FF Wang, QB Ma, YT Lu, TT Yuan (2018). SORTING NEXIN 1
functions in plant salt stress tolerance through changes of NO accumulation by
regulating NO synthase-like activity. Front Plant Sci 9; Article 1634
Liu H, H Zhao, L Wu, A Liu, F J Zhao, W Xu (2017). Heavy metal ATPase 3
(HMA3) confers cadmium hypertoleranceon the cadmium/zinc hyperaccumulator Sedum
plumbizincicola. New Phytol 215:687‒698
Lu C, L Zhang, Z Tang, X Huang, J Ma, F Zhao (2019). Producing
cadmium-free Indica rice by overexpressing OsHMA3.
Environ Intl 126:619‒626
Mani A, K Sankaranarayanan (2018). In
silico analysis of natural resistance-associated macrophage protein (NRAMP)
family of transporters in rice. Protein J 37:237‒247
Meng JG, XD Zhang, SK Tan, KX Zhao, ZM Yang (2017). Genome-wide
identification of Cd-responsive NRAMP
transporter genes and analyzing expression of NRAMP 1 mediated by miR167 in Brassica
napus. Biometals 30:917‒931
Nevo Y, N Nelson (2006). The NRAMP family of metal-ion transporters. Biochim
Biophys Acta 1763:609‒620
Nodzyński T, MI Feraru, S Hirsch, RD Rycke, C Niculaes, W Boerjan,
JV Leene, GD Jaeger, S Vanneste, J Friml (2013). Retromer subunits VPS35A and
VPS29 mediate prevacuolar compartment (PVC) function in Arabidopsis. Mol Plant 6:1849‒1862
Ozturk F, F Duman, Z Leblebici, R Temizgul (2010). Arsenic accumulation
and biological responses of watercress (Nasturtium
officinale R. Br.) exposed to arsenite. J Exp Bot 69:167‒174
Pan H, Y Wang, Q Zha, M Yuan, L Yin, T Wu, X Zhang, X Xu, Z Han (2015).
Iron deficiency stress can induce MxNRAMP1
protein endocytosis in M. xiaojinensis.
Gene 567:225‒234
Pech JC, M Bouzayen, A Latchq (2008). Climacteric fruit ripening:
ethylene-dependent and independent regulation of ripening pathways in melon
fruit. Plant Sci 175:114‒120
Peris-Peris C, A Serra-Cardona, F Sánchez-Sanuy, S Campo, J Ariño, BS
Segundo (2017). Two NRAMP6 isoforms
function as iron and manganese transporters and contribute to disease
resistance in rice. molecular plant-microbe interactions. Mol Plant Microb
30:385‒398
Pontier D, C Albrieux, J Joyard, T Lagrange, MA Block (2007). Knock-out
of the magnesium protoporphyrin IX methyltransferase gene in Arabidopsis: effect on chloroplast
development and on chloroplast-to-nucleus signaling. J Biol Chem
282:2297‒2304
Qiao H, Z Shen, S Carol Huang, RJ Schmitz, MA Urich, SP Briggs, JR
Ecker (2012). Processing and subcellular trafficking of ER-tethered EIN2 control
response to ethylene gas. Science 338:390‒393
Qin L, P Han, L Chen, TC Walk, Y Li, X Hu, L Xie, H Liao, X Liao (2017).
Genome-wide identification and expression analysis of NRAMP family genes in soybean (Glycine max L.). Front
Plant Sci 8; Article 1436
Qiu T, Y Chen, M Li, Y Kong, Y Zhu, N Han, H Bian, M Zhu, J Wang
(2013). The tissue-specific and developmentally regulated expression patterns
of the SAUR41 subfamily of small
auxin up RNA genes: potential implications. Plant Signal Behav 8;
Article e25283
Reinbothe C, S Bartsch, LL Eggink, JK Hoober, J Brusslan, R
Andrade-Paz, J Monnet, S Reinbothe (2006). A role for chlorophyllide a
oxygenase in the regulated import and stabilization of light-harvesting
chlorophyll a/b proteins. Proc Natl Acad Sci USA 103:4777‒4782
Saito T, P Opio, S Wang, K Ohkawa, S Kondo, T Maejima, H Ohara (2019).
Association of auxin, cytokinin, abscisic acid, and plant peptide response
genes during adventitious root formation in Marubakaido apple rootstock (Malus prunifolia Borkh. var. ringo
Asami). Acta Physiol Plantarum 41; Article 41
Sasaki A, N Yamaji, K Yokosho, JF Ma (2012). Nramp5 is a major
transporter responsible for manganese and cadmium uptake in rice. Plant Cell
24:2155‒2167
Shannon P, A Markiel, O Ozier, NS Baliga, JT Wang, D Ramage, N Amin, B
Schwikowski, T Ideker (2003). Cytoscape: A software environment for integrated
models of biomolecular interaction networks. Genomic Res 13:2498‒2504
Supek F, L Supekova, H Nelson, N Nelson (1996). A yeast manganese
transporter related to the macrophage protein involved in conferring resistance
to mycobacteria. Proc Natl Acad Sci USA 93:5105‒5110
Szklarczyk D, AL Gable, D Lyon, A Junge, S Wyder, J Huerta-Cepas, M
Simonovic, NT Doncheva, JH Morris, P Bork, LJ Jensen, C von Mering (2019). STRING
v11: protein-protein association networks with increased coverage, supporting
functional discovery in genome-wide experimental datasets. Nucl Acids Res
47:607‒613
Tamura K, D Peterson, N Peterson, G Stecher, M Nei, S Kumar (2011).
MEGA5: Molecular evolutionary genetics analysis using maximum likelihood,
evolutionary distance, and maximum parsimony methods. Mol Biol Evol
28:2731‒2739
Tang QY, CX Zhang (2013). Data Processing System (DPS) software with
experimental design, statistical analysis and data mining developed for use in
entomological research. Ins Sci 20:254‒260
Verbruggen N, C Hermans, H Schat (2009). Mechanisms to cope with
arsenic or cadmium excess in plants. Curr Opin Plant Biol 12:364‒372
Vidal SM, D Malo, K Vogan, E Skamene, P Gros (1993). Natural resistance
to infection with intracellular parasites: isolation of a candidate for Bcg. Cell
73:469‒485
Wang H, T Wang, I Ahmad (2015). Involvement of phosphate supplies in
different transcriptional regulation pathway of Oryza sativa L.’s antioxidative system in response to arsenite and
cadmium stress. Ecotoxicology 24:1259‒1268
Xia J, N Yamaji, T Kasai, JF Ma (2010). Plasma membrane localized
transporter for aluminum in rice. Proc Natl Acad Sci USA 107:18381‒18385
Xiao H, L Yin, X Xu, T Li, Z Han (2008). The iron-regulated
transporter, MbNRAMP1, isolated from
Malus baccata is involved in Fe, Mn and Cd trafficking. Ann Bot 102:881‒889
Xie Y, L Xu, Y Wang, L Fan, Y Chen, M Tang, X Luo, L Liu (2018).
Comparative proteomic analysis provides insight into a complex regulatory
network of taproot formation in radish (Raphanus sativus L.). Hortic
Res 5:51–64
Xiong H, T Kobayashi, Y Kakei, T Senoura, M Nakazono, H Takahashi, H
Nakanishi, H Shen, P Duan, X Guo, N Nishizawa, Y Zuo (2012). AhNRAMP1 iron transporter in involved in
iron acquisition in peanut. J Exp Bot 63:4437‒4446
Xiong M, X Zhang, S Shabala, L Shabala, Y Chen, C Xiang, MA Nawaz, Z
Bie, H Wu, H Yi, M Wu, Y Huang (2018). Evaluation of salt tolerance and
contributing ionic mechanism in nine Hami melon landraces in Xinjiang, China. Sci
Horitc 237:277‒286
Yamaji N, A Sasaki, JX Xia, K Yokosho, JF Ma (2013). A node-based
switch for preferential distribution of manganese in rice. Nat Commun
4; 2442
Yamazaki N, T Shimada, H Takahashi, K Tamura, M Kondo, M Nishimura, I
Hara-Nishimura (2008). Arabidopsis
VPS35, a retromer component, is required for vacuolar protein sorting and
involved in plant growth and leaf senescence. Plant Cell Physiol 49:142‒156
Yuan X, P Yin, Q Hao, C Yan, J Wang, N Yan (2010). Single amino acid
alteration between valine and isoleucine determines the distinct pyrabactin
selectivity by PYL1 and PYL2. J Biol Chem 285:28953‒28958
Zha Q, Y Wang, XZ Zhang, ZH Han (2014). Both immanently high active
iron contents and increased root ferrous uptake in response to low iron stress
contribute to the iron deficiency tolerance in Malus xiaojinensis. Plant Sci 214:47‒56
Zhang N, R Kaur, S Akhter, RJ Legerski (2009). Cdc5L interacts with ATR
and is required for the S-phase cell-cycle checkpoint. EMBO Rep 10:1029‒1035
Zheng Y, S Wu, Y Bai, H Sun, C Jiao, S Guo, ZK Hao, J Blanca, Z Zhang,
S Huang, Y Xu, Y Weng, M Mazourek, UK Reddy, K Ando, JD McCreight, AA Schaffer,
J Burger, Y Tadmor, N Katzir, X Tang, Y Liu, JJ Giovannoni, KS Ling, WP
Wechter, A Levi, J Garcia-Mas, R Grumet, Z Fei (2019). Cucurbit Genomics
Database (CuGenDB): a central portal for comparative and functional genomics of
cucurbit crops. Nucl Acids Res 47:1128‒1136
Zhu XF, Q Wu, L Zheng, RF Shen (2017). NaCl alleviates iron deficiency
through facilitating root cell wall iron reutilization and its translocation to
the shoot in Arabidopsis thaliana. Plant
Soil 417:155‒167
Zlobin IE, VP Kholodova, ZF Rakhmankulova, VV Kuznetsov (2015). Brassica
napus responses to short-term excessive copper treatment with decrease of
photosynthetic pigments, differential expression of heavy metal homeostasis
genes including activation of gene NRAMP4
involved in photosystem II stabilization. Photosynth Res 125:141‒150